Struktur dan Fungsi Polinukleotida

By On Saturday, February 25th, 2017 Categories : Sains

Bergabung dengan sekelompok nukleotida bersama-sama, dan Anda mendapatkan sebuah polinukleotida. Ini bisa menjadi untai panjang DNA dalam sel atau untai pendek yang digunakan oleh para ilmuwan di laboratorium.

Pelajari tentang struktur dan berbagai jenis polinukleotida dalam artikel ini.

Definisi

Sebuah polinukleotida merupakan polimer, atau rantai, nukleotida. Anda mungkin pernah mendengar tentang sepasang terkenal polinukleotida disebut DNA. Sepupu RNA adalah juga sebuah polinukleotida. Dalam pelajaran ini, kita akan belajar bagaimana nukleotida bergabung bersama untuk membuat untai polinukleotida.

Struktur

Pikirkan tali bendera – misal pada upacara bendera atau bahkan bendera Anda mungkin yang akan lihat di dealer mobil. Tali yang dimaksud ada seperti tulang punggung yang memegang bendera bersama-sama.
Sebuah polinukleotida memiliki tulang belakang juga. Ini terbuat dari gula dan fosfat bagian nukleotida, jadi kita menyebutnya sebagai tulang punggung gula-fosfat.

 Bendera adalah seperti basa nitrogen. Sama seperti sehelai bendera dapat memiliki urutan – mengatakan ‘merah, merah, biru, merah, hijau …’ – Untai polinukleotida memiliki urutan basa. Alih-alih warna, basa memiliki nama kimia yang berbeda. Dalam DNA, basa adalah adenin, guanin, sitosin, dan timin. Ini berarti bahwa urutan polinukleotida yang akan terlihat seperti:

ACGTCGTATATCGTAGCTGTCAGTCGAGTAC …

(polinukleotida RNA adalah sedikit berbeda, basa mereka meliputi adenin, guanin, sitosin, dan urasil Mereka juga memiliki berbagai jenis gula dalam tulang punggung mereka..)

Bagaimana Nukleotida Bergabung Bersama

Setiap nukleotida memiliki basa, gula, dan fosfat. Sebuah enzim yang disebut polimerase bergabung dengan gula ke fosfat. (Sejak polinukleotida masuk dalam dua jenis – DNA dan RNA – masing-masing memiliki polimerase sendiri.)

Polinukleotida pada dnaPolimerase menambahkan nukleotida baru ke bagian bawah untai, yang kita sebut ujung 3? (diucapkan ‘prime tiga’) . Bagian atas untai disebut ujung 5?. (Nama-nama berasal dari mana gugus fosfat yang menempel:. Pada karbon ketiga atau kelima gula ini)

Dalam polinukleotida ganda, seperti DNA, dua untai yang antiparalel. Ini berarti bahwa satu adalah relatif terbalik terhadap yang lain, dengan ujung dekat ujung 5? yang lain 3?.

Jenis & Fungsi

DNA dan RNA adalah dua jenis polinukleotida yang ditemukan di alam. Masing-masing dari 46 kromosom dalam sel Anda adalah untai ganda DNA, yang berarti dua polinukleotida dengan urutan yang cocok, saling menempel. polinukleotida ini jutaan basa panjang (pikirkan jutaan bendera pada setiap untai).

Di dalam sel, banyak pekerjaan penting yang dilakukan oleh polinukleotida lebih pendek dari RNA. RNA Messenger, yang membawa instruksi untuk membangun protein, adalah untai tunggal yang biasanya panjang beberapa ribu basa. RNA Transfer, yang memiliki pekerjaan yang berbeda dalam membangun protein, kurang dari seratus basa.

Para ilmuwan juga dapat membuat helai polinukleotida di laboratorium. Salah satu proses yang umum disebut Polymerase Chain Reaction, atau PCR, membuat salinan DNA. Untuk mendapatkan proses dimulai, ilmuwan akan menambah polinukleotida pendek, disebut primer, yang panjang sekitar 20 basa.

Ringkasan

Sehelai polinukleotida terbuat dari tulang punggung gula-fosfat (seperti tali dalam untai bendera) dan berbagai basa (seperti bendera), satu per nukleotida. Sebuah polinukleotida dibuat ketika enzim Polimerase nukleotida bergabung bersama-sama. Untai memiliki dua ujung yang berbeda, yang kita sebut 3 ‘dan 5’. Polinukleotida membentuk DNA yang membawa gen kita, RNA yang melakukan banyak pekerjaan dalam sel kita, dan ahli biologi juga dapat menggunakan polinukleotida sebagai alat di laboratorium.